|
"If you have access to a real-time PCR instrument, you can use
miRNA PCR Arrays"
The RT² miRNA PCR Arrays are the state-of-the-art
solution for detecting and analyzing micro RNA using any real-time PCR
instrument - whether you need to see the entire human miRNA genome or specific
panels of miRNA sequences focused on your research. Genome-wide miRNA PCR
Arrays discover novel functional roles for miRNA sequences. Disease- or
pathway-focused miRNA PCR Arrays screen panels of miRNA sequences known to be
associated with cancer or development in new model systems. The miRNA PCR
Arrays can be used for research on cancer, immunology, stem cells, or biomarker
discovery and validation as well as phenotypic analysis of cells or transgenic
animals. See the complete list of miRNA PCR Arrays.
How it Works
The miRNA PCR array is a set of optimized real-time PCR assays, in 96-well or
384-well plates, for a miRNA panel as well as appropriate housekeeping assays
and RNA quality controls. The PCR Array performs miRNA expression analysis with
real-time RT-PCR sensitivity and the multi-sequence profiling capabilities of a
microarray. Simply mix your cDNA template with the appropriate ready-to-use PCR
master mix, aliquot equal volumes to each well of the same plate, and then run
the real-time PCR cycling program. (Download user manual)
| Figure 1: |
How PCR Arrays Work - Protocol Chart |
|
What it offers?
Guaranteed
Performance* - ready-to-use for gene
expression analysis
Time and cost saving - less than 30 min hands-on
time to analyze 88 or 376 miRNA
Ease of
data analysis - easy-to-use Excel-Based Data Analysis Template
Layout and Controls: The miRNA PCR Arrays are available in both 96-
and 384-well plates and are used to monitor the expression of 88 or 376 miRNA,
respectively, plus four housekeeping
assays for small nuclear RNA to normalize raw data. Controls are also
included on each array for RNA quality and general PCR performance.
You can easily perform a PCR Array experiment in your own laboratory, or send
your samples to us and take advantage of our PCR
Array Gene Expression Analysis Services.
*: when using complete miRNA PCR array system.
Performance Data:
Real-time RT-PCR is the most sensitive and reliable method
for analyzing the expression of nucleic acids like miRNA. Its wide dynamic range
makes it the preferred choice for simultaneously quantifying both rare and
abundant sequences in the same sample. However, the small size and high degree
of similarity among miRNA sequences makes quantitative analyses of their
abundance very challenging. Any assay for miRNA must not only demonstrate the
sensitivity and reproducibility expected of real-time PCR, but also be specific
enough to discriminate between sequences that differ by as little as one
mismatch to achieve that high level of performance.
The patent-pending technologies in the miRNA PCR Array System
dramatically improve specificity for closely related mature miRNA over
their precursors. The uniformly high PCR amplification efficiencies of the
built-in assays simultaneously detect any miRNA sequence in the human
genome with high sensitivity and specificity. The experimental results
below will show that the RT² miRNA PCR Array and Assay System meets these
performance criteria.
Improved Discrimination & Specificity:
The proprietary primer design of the RT² miRNA PCR Array and Assays
distinguishes miRNA family members with single nucleotide mismatches
providing greater discrimination and specificity than other commercial
providers.
Synthetic
miRNA Template
|
Assay Primers
|
Relative
Detection
(%Perfect Match)
|
miRNA Template Sequence |
| miR-10a |
miR-10a |
100.00 |
UACCCUGUAGAUCCGAAUUUGUG |
| miR-10b |
0.98 |
| miR-10b |
miR-10b |
100.00 |
UACCCUGUAGAACCGAAUUUGUG |
| miR-10a |
0.01 |
| miR-99a |
mir-99a |
100.00 |
AACCCGUAGAUCCGAUCUUGUG |
| miR-100 |
0.54 |
| miR-100 |
miR-100 |
100.00 |
AACCCGUAGAUCCGAACUUGUG |
| mir-99a |
0.07 |
| miR-196a |
miR-196a |
100.00 |
UAGGUAGUUUCAUGUUGUUGGG |
| miR-196b |
0.20 |
| miR-196b |
miR-196b |
100.00 |
UAGGUAGUUUCCUGUUGUUGGG |
| miR-196a |
1.64 |
|
Relative
detection as a percent of the
perfect match (100 x 2- ΔΔCt)
is calculated from the Ct
values of target and off-target
assays used to detect 105
copies of synthetic miRNA
template. The observed
cross-reactivity seen between
RT² miRNA qPCR Assays for
different miRNA species are
compared. |
Specific Detection Improves Sensitivity & Dynamic Range
The patent-pending chemistry of the RT² miRNA First Strand Kit preferentially
reverse transcribes mature miRNA, thereby decreasing non-specific background and
increasing sensitivity.
| Figure 2: |
Synthetic mir-658 was serially
diluted into a constant amount (100 ng) of small RNA enriched from 293H
cells lacking that sequence. Samples were analyzed with mir-658-specific
RT² miRNA qPCR Assays and other commercial assays. The resulting
threshold cycles of the assays are plotted versus the log10 of the
number of mir-658 template copies. The RT² miRNA PCR Assays provide
three orders of magnitude greater sensitivity than competing assays,
which amplify non-specific products more evident at lower amounts of
input material.
|
|
High Reproducibility
Reliably compare results across cycling runs, arrays, plates, and samples.
| Figure 3: |
Duplicate samples of small RNA
enriched from human brain tissue (Ambion, 200 ng) were characterized
using the RT² Human Genome miRNA PCR array on an ABI 7900HT. Raw Ct
values greater than 35 or reported as "not determined" were
first changed to 35. The values from the replicate arrays were plotted
against each other, and then the data was fit to a straight line. The
miRNA PCR Arrays demonstrate high degrees of technical reproducibility
with strong correlation factors (R2 > 0.99).
|
|
Application Data
The regulated expression of miRNA adds another layer to an already
complex gene regulatory network. One miRNA can regulate multiple mRNA
targets, and one target mRNA may be regulated by multiple miRNA sequences.
Therefore, the role that any given miRNA sequence plays has yet to be
completely defined. Correlating miRNA expression profiles to biological
phenotypes adds to our understanding of miRNA-based gene regulation.
Analyzing a representative set of sequences with the Genome or miFinder
arrays discovers novel functional roles for each miRNA. Focused miRNA
panels, like those on the Cancer or the Cell Differentiation and
Development arrays, screen miRNA biomarkers known to be most important to
their specific model system. The representative results below will
illustrate experiments that may be performed with the RT² miRNA PCR Array
and Assay System.
Cancer Research: Identifying miRNA Cancer Biomarkers
The RT² Human Cancer miRNA PCR Array identifies potential colon cancer
biomarkers. Many of the miRNA sequences are up-regulated in colon cancer.
| Figure 4: |
Small RNA isolated from human colon tumor and matched adjacent
normal tissue (Biochain) was characterized with PCR Arrays containing assays
specific for 88 cancer-related human miRNA sequences. The fold-differences
plotted for each miRNA are calculated from via the ΔΔCt method and raw data
normalized to a panel of housekeeping small nuclear RNA. |
|
Development Research: Identifying Tissue-Specific miRNA Biomarkers
The RT² Human Cell Differentiaion & Development miRNA PCR Array
identifies 26 brain- and 20 muscle-specific miRNA.
| Figure 5: |
Small RNA enriched from human brain and muscle tissue total RNA
(200 ng, Ambion) were characterized with PCR Arrays containing assays for 88
differentiation-related miRNA sequences. Normalized miRNA sequence expression
levels for both tissues are calculated and plotted against each other. Symbols
outside the red lines represent miRNA with at least a 2-fold expression
difference in the respective tissues.
|
|
Signal Transduction Research: Screen the Genome for p53-Responsive miRNA
RT² Human Genome miRNA PCR Array identifies known and novel miRNA sequences
responsive to p53 over-expression. The array identifies the well-known p53
targets, mir-34a and mir-34c, as well as a dozen new candidate targets including
mir-203, mir-551a, mir-940, mir-614, and others.
| Figure 6: |
PC3 cells were transduced with adenovirus either encoding p53 or
containing an empty vector. After 48 h, small RNA was characterized with PCR
Arrays containing 376 human miRNA-specific assays. The heat map visualizes the
fold-differences in miRNA expression upon p53 over-expression (red, up-regulated
miRNA; green, down-regulated miRNA; black, no difference). |
|
Back to Top
|
