|
Real-time RT-PCR is the most sensitive and reliable method for analyzing the
expression of nucleic acids like miRNA. Its wide dynamic range makes it the
preferred choice for simultaneously quantifying both rare and abundant sequences
in the same sample. However, the small size and high degree of similarity among
miRNA sequences makes quantitative analyses of their abundance very challenging.
Any assay for miRNA must not only demonstrate the sensitivity and
reproducibility expected of real-time PCR, but also be specific enough to
discriminate between sequences that differ by as little as one mismatch. The
experimental results below will show that the RT² miRNA PCR Array and Assay
System meets these performance criteria.
RT² miRNA Assay Design Improves Discrimination & Specificity
The proprietary primer design of the RT² miRNA PCR Array and Assays
distinguishes miRNA family members with single nucleotide mismatches providing
greater discrimination and specificity than other commercial providers.
Synthetic
miRNA Template
|
Assay Primers
|
Relative
Detection
(%Perfect Match)
|
miRNA Template Sequence |
| miR-10a |
miR-10a |
100.00 |
UACCCUGUAGAUCCGAAUUUGUG |
| miR-10b |
0.98 |
| miR-10b |
miR-10b |
100.00 |
UACCCUGUAGAACCGAAUUUGUG |
| miR-10a |
0.01 |
| miR-99a |
mir-99a |
100.00 |
AACCCGUAGAUCCGAUCUUGUG |
| miR-100 |
0.54 |
| miR-100 |
miR-100 |
100.00 |
AACCCGUAGAUCCGAACUUGUG |
| mir-99a |
0.07 |
| miR-196a |
miR-196a |
100.00 |
UAGGUAGUUUCAUGUUGUUGGG |
| miR-196b |
0.20 |
| miR-196b |
miR-196b |
100.00 |
UAGGUAGUUUCCUGUUGUUGGG |
| miR-196a |
1.64 |
|
Relative
detection as a percent of the
perfect match (100 x 2- ΔΔCt)
is calculated from the Ct
values of target and off-target
assays used to detect 105
copies of synthetic miRNA
template. The observed
cross-reactivity seen between
RT² miRNA qPCR Assays for
different miRNA species are
compared. |
Specifically Detecting Mature miRNA Improves Sensitivity
The patent-pending chemistry of the RT² miRNA First Strand Kit
preferentially reverse transcribes mature miRNA, thereby decreasing non-specific
background and increasing sensitivity. The RT² miRNA PCR Assays provide three
orders of magnitude greater sensitivity than competing assays. Other assays can
amplify non-specific products that tend to be more evident at lower amounts of
input material.
Synthetic mir-658 was serially diluted into a constant amount
(100 ng) of small RNA enriched from 293H cells lacking that sequence. Samples
were analyzed with mir-658-specific RT² miRNA qPCR Assays and other commercial
assays. The resulting threshold cycles of the assays are plotted versus the log10
of the number of mir-658 template copies.
RT² miRNA Arrays and Assays Have Wide Linear Dynamic Ranges
Assays demonstrate linearity from 400 ng to as low as 10 pg input small RNA or
from 100 to 1010 copies of miRNA cDNA template. The wide dynamic
range means that miRNA sequences expressed at a wide variety of expression
levels can be detected simultaneously.
Eight four-fold serial dilutions from 400 ng of 293-H small RNA,
enriched from total RNA, were used with the RT² miRNA First Strand Kit and RT²
miRNA qPCR Assays specific for mir-16 and mir-21. The resulting cycles of the
assays are plotted versus the log10 of the amount of input small RNA.
RT² miRNA Arrays and Assays Demonstrate High Reproducibility
The miRNA PCR Arrays demonstrate high degrees of technical reproducibility
with strong correlation factors (R2 > 0.99). This level of
reproducibility means that results can be reliably compared across cycling runs,
arrays, plates, and samples.
Duplicate samples of small RNA enriched from human brain tissue
(Ambion, 200 ng) were characterized using the RT² Human Genome miRNA PCR array
on an ABI 7900HT. Raw Ct values greater than 35 were first changed to 35. The
values from the replicate arrays were plotted against each other, and then the
data was fit to a straight line.
|
