Applications
Complete Array List
Pathway
Apoptosis
Biomarkers
Cell Cycle
Cytokine & Inflammation
ECM & Adhesion
Neuroscience
Signal Transduction
Stem Cell & Development
Toxicology & Drug ADME
Diseases
Cancer
Cardiovascular Diseases
CNS Disorders
Immune Disorders
Infectious Diseases
Metabolic Diseases
 
Home  >  Products  >  miRNA Home  >  miRNA PCR Arrays
RT² miRNA PCR Array
Simultaneous Detection of Genome-Wide or Pathway-Focused miRNA

The RT² miRNA PCR Array accurately analyzes the expression of multiple micro RNA sequences at the same time on ANY real-time PCR instrument. Each 96- or 384-well plate contains SYBR Green optimized and experimentally validated assays for either the entire human miRNA genome or pathway-focused sets of human miRNA sequences. Our proprietary miRNA detection technologies enable uniformly high PCR amplification efficiencies, allowing simultaneous detection of miRNA under uniform cycling conditions. These technologies also provide the RT² miRNA PCR Array with high sensitivity, specificity and accuracy. Four miRNA arrays are currently available:

Available miRNA PCR Arrays:

Human Cancer miRNA PCR Array
Human Cell Differentiation & Development miRNA PCR Array
Human Genome miRNA PCR Array, 96-Well
Human Genome miRNA PCR Array, 384-Well
Human miFinder miRNA PCR Array

Why miRNA PCR Arrays?

  • Biologically Relevant: Arrays represent the entire human miRNA genome or a pathway- or disease-focused panel such as cancer and development.
  • Reliable, Sensitive, Specific: Simple real-time PCR method with optimized primer design and reaction formulation improves discrimination and sensitivity.
  • Simple & Easy to Use: Brings miRNA expression profiling to almost any lab with a real-time PCR instrument.

Performance
Discrimination & Specificity, Sensitivity & Dynamic Range, Reproducibility

Real-time RT-PCR is the most sensitive and reliable method for analyzing the expression of nucleic acids like miRNA. Its wide dynamic range makes it the preferred choice for simultaneously quantifying both rare and abundant sequences in the same sample. However, the small size and high degree of similarity among miRNA sequences makes quantitative analyses of their abundance very challenging. Any assay for miRNA must not only demonstrate the sensitivity and reproducibility expected of real-time PCR, but also be specific enough to discriminate between sequences that differ by as little as one mismatch. The experimental results below will show that the RT² miRNA PCR Array and Assay System meets these performance criteria.

RT² miRNA Assay Design Improves Discrimination & Specificity
The proprietary primer design of the RT² miRNA PCR Array and Assays distinguishes miRNA family members with single nucleotide mismatches providing greater discrimination and specificity than other commercial providers.


Synthetic
miRNA Template
Assay Primers Relative Detection
(%Perfect Match)
 miRNA Template Sequence
miR-10a miR-10a 100.00 UACCCUGUAGAUCCGAAUUUGUG
miR-10b 0.98
miR-10b miR-10b 100.00 UACCCUGUAGAACCGAAUUUGUG
miR-10a 0.01
miR-99a mir-99a 100.00 AACCCGUAGAUCCGAUCUUGUG
miR-100 0.54
miR-100 miR-100 100.00 AACCCGUAGAUCCGAACUUGUG
mir-99a 0.07
miR-196a miR-196a 100.00 UAGGUAGUUUCAUGUUGUUGGG
miR-196b 0.20
miR-196b miR-196b 100.00 UAGGUAGUUUCCUGUUGUUGGG
miR-196a 1.64

Relative detection as a percent of the perfect match (100 x 2- ΔΔCt) is calculated from the Ct values of target and off-target assays used to detect 105 copies of synthetic miRNA template. The observed cross-reactivity seen between RT² miRNA qPCR Assays for different miRNA species are compared.

Specifically Detecting Mature miRNA Improves Sensitivity
The patent-pending chemistry of the RT² miRNA First Strand Kit preferentially reverse transcribes mature miRNA, thereby decreasing non-specific background and increasing sensitivity. The RT² miRNA PCR Assays provide three orders of magnitude greater sensitivity than competing assays. Other assays can amplify non-specific products that tend to be more evident at lower amounts of input material.

Synthetic mir-658 was serially diluted into a constant amount (100 ng) of small RNA enriched from 293H cells lacking that sequence. Samples were analyzed with mir-658-specific RT² miRNA qPCR Assays and other commercial assays. The resulting threshold cycles of the assays are plotted versus the log10 of the number of mir-658 template copies.

RT² miRNA Arrays and Assays Have Wide Linear Dynamic Ranges
Assays demonstrate linearity from 400 ng to as low as 10 pg input small RNA or from 100 to 1010 copies of miRNA cDNA template. The wide dynamic range means that miRNA sequences expressed at a wide variety of expression levels can be detected simultaneously.

Eight four-fold serial dilutions from 400 ng of 293-H small RNA, enriched from total RNA, were used with the RT² miRNA First Strand Kit and RT² miRNA qPCR Assays specific for mir-16 and mir-21. The resulting cycles of the assays are plotted versus the log10 of the amount of input small RNA.

RT² miRNA Arrays and Assays Demonstrate High Reproducibility
The miRNA PCR Arrays demonstrate high degrees of technical reproducibility with strong correlation factors (R2 > 0.99). This level of reproducibility means that results can be reliably compared across cycling runs, arrays, plates, and samples.

Duplicate samples of small RNA enriched from human brain tissue (Ambion, 200 ng) were characterized using the RT² Human Genome miRNA PCR array on an ABI 7900HT. Raw Ct values greater than 35 were first changed to 35. The values from the replicate arrays were plotted against each other, and then the data was fit to a straight line.

Applications
For Cancer, Development, and Signal Transduction Research

The regulated expression of miRNA adds another layer to an already complex gene regulatory network. One miRNA can regulate multiple mRNA targets, and one target mRNA may be regulated by multiple miRNA sequences. Therefore, the role that any given miRNA sequence plays has yet to be completely defined. Correlating miRNA expression profiles to biological phenotypes adds to our understanding of miRNA-based gene regulation. Analyzing a representative set of sequences with the Genome array discovers novel functional roles for each miRNA. Focused miRNA panels, like those on the Cancer or the Cell Differentiation and Development arrays, screen known miRNA biomarkers for those most important to a model system. The representative results below will illustrate experiments that may be performed with the RT² miRNA PCR Array and Assay System.

Cancer Research: Identifying miRNA Cancer Biomarkers
The RT² Human Cancer miRNA PCR Array identifies potential colon cancer biomarkers. Many of the miRNA sequences are up-regulated in colon cancer.

Small RNA isolated from human colon tumor and matched adjacent normal tissue (Biochain) was characterized with PCR Arrays containing assays specific for 88 cancer-related human miRNA sequences. The fold-differences plotted for each miRNA are calculated from via the ΔΔCt method and raw data normalized to a panel of housekeeping small nuclear RNA.

Development Research: Identifying Tissue-Specific miRNA Biomarkers
The RT² Human Cell Differentiaion & Development miRNA PCR Array identifies 26 brain- and 20 muscle-specific miRNA.

Small RNA enriched from human brain and muscle tissue total RNA (200 ng, Ambion) were characterized with PCR Arrays containing assays for 88 differentiation-related miRNA sequences. Normalized miRNA sequence expression levels for both tissues are calculated and plotted against each other. Symbols outside the red lines represent miRNA with at least a 2-fold expression difference in the respective tissues.

Signal Transduction Research: Screen the Genome for p53-Responsive miRNA
RT² Human Genome miRNA PCR Array identifies known and novel miRNA sequences responsive to p53 over-expression. The array identifies the well-known p53 targets, mir-34a and mir-34c, as well as a dozen new candidate targets including mir-203, mir-551a, mir-940, mir-614, and others.

PC3 cells were transduced with adenovirus either encoding p53 or containing an empty vector. After 48 h, small RNA was characterized with PCR Arrays containing 376 human miRNA-specific assays. The heat map visualizes the fold-differences in miRNA expression upon p53 over-expression (red, up-regulated miRNA; green, down-regulated miRNA; black, no difference).

How It Works

Simple Workflow
Simply mix cDNA template, generated from our first strand kit, with the appropriate ready-to-use PCR master mix. Then, aliquot equal volumes to each well of the same plate, and run the real-time PCR cycling program. PCR Arrays are compatible with all ABI, Bio-Rad, Stratagene and Roche instrumentation. Find the correct setup instructions and protocol files [here].
See the miRNA PCR Array Protocol Overview

Well Designed Layout and Controls
The miRNA PCR Arrays are available in both 96- and 384-well plates to monitor the expression of 88 or 376 miRNA sequences either from the entire human genome or an application-focused panel. Four housekeeping sequences and other controls are also included on each array for data normalization, RNA quality and general PCR performance. Click [here] to learn how the control features work.
See the Layout of the miRNA Assays and Controls on the qPCR Array

Easy-to-Use Data Analysis
Download an easy-to-use Excel-based data analysis template [here]. Data analysis is based on the ΔΔCt method with normalization of the raw data to one or more of the housekeeping assays.

You can easily perform a miRNA PCR Array experiment in your own laboratory, or send your samples to us and take advantage of our PCR Array Gene Expression Analysis Services.

PRODUCT SUPPORT

Technical Support

Working Protocol Required Reagents and Instruments
Overview of miRNA PCR Arrays Performance Data
User Manual Application Examples

Presentations

View a Slide Presentation Attend a Live Web Seminar

Purchase Support

RT² miRNA PCR Array RT² miRNA PCR Assay
Instrument-Specific qPCR Master Mix
Products Menu
miRNA Home
miRNA PCR Array
Custom PCR Arrays
PCR Array Services
miRNA qPCR Assay
Find Your miRNA
miRNA qPCR Services
qPCR Master Mixes
Related Products
Reagents & Equipment
miRNA Data Analysis
RT² Profiler PCR Arrays
PCR Accessories
Product Support
Pricing and Ordering
User Manuals
PCR Array Buyer’s Guide
Presentations
E-mail a Question/Suggestion
Sample Results
Copyright © 2008 SuperArray Bioscience Corporation