|
The RT² miRNA PCR Array accurately analyzes the expression of
multiple micro RNA sequences at the same time on ANY real-time PCR instrument.
Each 96- or 384-well plate contains SYBR Green optimized and experimentally
validated assays for either the entire human miRNA genome or pathway-focused
sets of human miRNA sequences. Our proprietary miRNA detection technologies
enable uniformly high PCR amplification efficiencies, allowing simultaneous
detection of miRNA under uniform cycling conditions. These technologies also
provide the RT² miRNA PCR Array with high sensitivity, specificity and accuracy.
Four miRNA arrays are currently available: Available miRNA PCR
Arrays:
Human Cancer miRNA PCR Array
Human Cell Differentiation &
Development miRNA PCR Array
Human
Genome miRNA PCR Array, 96-Well
Human Genome miRNA PCR Array,
384-Well
Human miFinder miRNA PCR Array Why
miRNA PCR Arrays?
- Biologically Relevant: Arrays represent the entire human miRNA genome or a
pathway- or disease-focused panel such as cancer and development.
- Reliable, Sensitive,
Specific: Simple real-time PCR method with optimized
primer design and reaction formulation improves discrimination and
sensitivity.
- Simple & Easy to
Use: Brings miRNA expression profiling to almost any
lab with a real-time PCR instrument.
Performance
Discrimination & Specificity, Sensitivity & Dynamic Range,
Reproducibility
Real-time RT-PCR is the most sensitive and reliable method for analyzing the
expression of nucleic acids like miRNA. Its wide dynamic range makes it the
preferred choice for simultaneously quantifying both rare and abundant sequences
in the same sample. However, the small size and high degree of similarity among
miRNA sequences makes quantitative analyses of their abundance very challenging.
Any assay for miRNA must not only demonstrate the sensitivity and
reproducibility expected of real-time PCR, but also be specific enough to
discriminate between sequences that differ by as little as one mismatch. The
experimental results below will show that the RT² miRNA PCR Array and Assay
System meets these performance criteria.
RT² miRNA Assay Design Improves Discrimination & Specificity
The proprietary primer design of the RT² miRNA PCR Array and Assays
distinguishes miRNA family members with single nucleotide mismatches providing
greater discrimination and specificity than other commercial providers.
Synthetic
miRNA Template
|
Assay Primers
|
Relative
Detection
(%Perfect Match)
|
miRNA Template Sequence |
| miR-10a |
miR-10a |
100.00 |
UACCCUGUAGAUCCGAAUUUGUG |
| miR-10b |
0.98 |
| miR-10b |
miR-10b |
100.00 |
UACCCUGUAGAACCGAAUUUGUG |
| miR-10a |
0.01 |
| miR-99a |
mir-99a |
100.00 |
AACCCGUAGAUCCGAUCUUGUG |
| miR-100 |
0.54 |
| miR-100 |
miR-100 |
100.00 |
AACCCGUAGAUCCGAACUUGUG |
| mir-99a |
0.07 |
| miR-196a |
miR-196a |
100.00 |
UAGGUAGUUUCAUGUUGUUGGG |
| miR-196b |
0.20 |
| miR-196b |
miR-196b |
100.00 |
UAGGUAGUUUCCUGUUGUUGGG |
| miR-196a |
1.64 |
|
Relative
detection as a percent of the
perfect match (100 x 2- ΔΔCt)
is calculated from the Ct
values of target and off-target
assays used to detect 105
copies of synthetic miRNA
template. The observed
cross-reactivity seen between
RT² miRNA qPCR Assays for
different miRNA species are
compared. |
Specifically Detecting Mature miRNA Improves Sensitivity
The patent-pending chemistry of the RT² miRNA First Strand Kit
preferentially reverse transcribes mature miRNA, thereby decreasing non-specific
background and increasing sensitivity. The RT² miRNA PCR Assays provide three
orders of magnitude greater sensitivity than competing assays. Other assays can
amplify non-specific products that tend to be more evident at lower amounts of
input material.
Synthetic mir-658 was serially diluted into a constant amount
(100 ng) of small RNA enriched from 293H cells lacking that sequence. Samples
were analyzed with mir-658-specific RT² miRNA qPCR Assays and other commercial
assays. The resulting threshold cycles of the assays are plotted versus the log10
of the number of mir-658 template copies.
RT² miRNA Arrays and Assays Have Wide Linear Dynamic Ranges
Assays demonstrate linearity from 400 ng to as low as 10 pg input small RNA or
from 100 to 1010 copies of miRNA cDNA template. The wide dynamic
range means that miRNA sequences expressed at a wide variety of expression
levels can be detected simultaneously.
Eight four-fold serial dilutions from 400 ng of 293-H small RNA,
enriched from total RNA, were used with the RT² miRNA First Strand Kit and RT²
miRNA qPCR Assays specific for mir-16 and mir-21. The resulting cycles of the
assays are plotted versus the log10 of the amount of input small RNA.
RT² miRNA Arrays and Assays Demonstrate High Reproducibility
The miRNA PCR Arrays demonstrate high degrees of technical reproducibility
with strong correlation factors (R2 > 0.99). This level of
reproducibility means that results can be reliably compared across cycling runs,
arrays, plates, and samples.
Duplicate samples of small RNA enriched from human brain tissue
(Ambion, 200 ng) were characterized using the RT² Human Genome miRNA PCR array
on an ABI 7900HT. Raw Ct values greater than 35 were first changed to 35. The
values from the replicate arrays were plotted against each other, and then the
data was fit to a straight line.
Applications
For Cancer, Development, and Signal Transduction Research
The regulated expression of miRNA adds another layer to an already complex
gene regulatory network. One miRNA can regulate multiple mRNA targets, and one
target mRNA may be regulated by multiple miRNA sequences. Therefore, the role
that any given miRNA sequence plays has yet to be completely defined.
Correlating miRNA expression profiles to biological phenotypes adds to our
understanding of miRNA-based gene regulation. Analyzing a representative set of
sequences with the Genome array discovers novel functional roles for each miRNA.
Focused miRNA panels, like those on the Cancer or the Cell Differentiation and
Development arrays, screen known miRNA biomarkers for those most important
to a
model system. The representative results below will illustrate experiments that
may be performed with the RT² miRNA PCR Array and Assay System.
Cancer Research: Identifying miRNA Cancer Biomarkers
The RT² Human Cancer miRNA PCR Array identifies potential colon cancer
biomarkers. Many of the miRNA sequences are up-regulated in colon cancer.
Small RNA isolated from human colon tumor and matched adjacent
normal tissue (Biochain) was characterized with PCR Arrays containing assays
specific for 88 cancer-related human miRNA sequences. The fold-differences
plotted for each miRNA are calculated from via the ΔΔCt method and raw data
normalized to a panel of housekeeping small nuclear RNA.
Development Research: Identifying Tissue-Specific miRNA
Biomarkers
The RT² Human Cell Differentiaion & Development miRNA PCR Array identifies
26 brain- and 20 muscle-specific miRNA.
Small RNA enriched from human brain and muscle tissue total RNA
(200 ng, Ambion) were characterized with PCR Arrays containing assays for 88
differentiation-related miRNA sequences. Normalized miRNA sequence expression
levels for both tissues are calculated and plotted against each other. Symbols
outside the red lines represent miRNA with at least a 2-fold expression
difference in the respective tissues.
Signal Transduction Research: Screen the Genome for
p53-Responsive miRNA
RT² Human Genome miRNA PCR Array identifies known and novel miRNA sequences
responsive to p53 over-expression. The array identifies the well-known p53
targets, mir-34a and mir-34c, as well as a dozen new candidate targets including
mir-203, mir-551a, mir-940, mir-614, and others.
PC3 cells were transduced with adenovirus either encoding p53 or
containing an empty vector. After 48 h, small RNA was characterized with PCR
Arrays containing 376 human miRNA-specific assays. The heat map visualizes the
fold-differences in miRNA expression upon p53 over-expression (red, up-regulated
miRNA; green, down-regulated miRNA; black, no difference).
How It Works
Simple Workflow
Simply mix cDNA template, generated from our first strand kit, with the
appropriate ready-to-use PCR master mix. Then, aliquot equal volumes to each
well of the same plate, and run the real-time PCR cycling program. PCR Arrays
are compatible with all ABI, Bio-Rad, Stratagene and Roche instrumentation. Find
the correct setup instructions and protocol files [here].
See
the miRNA PCR Array Protocol Overview
Well
Designed Layout and Controls
The miRNA PCR Arrays are available in both 96- and 384-well plates to monitor
the expression of 88 or 376 miRNA sequences either from the entire human genome
or an application-focused panel. Four housekeeping sequences and other controls
are also included on each array for data normalization, RNA quality and general
PCR performance. Click [here] to
learn how the control features work.
See the Layout of the miRNA Assays and
Controls on the qPCR Array
Easy-to-Use Data
Analysis
Download an easy-to-use Excel-based data analysis template [here]. Data analysis
is based on the ΔΔCt method with normalization of the raw data to one or more of
the housekeeping assays.
You can easily perform a miRNA PCR Array
experiment in your own laboratory, or send your samples to us and take advantage
of our PCR Array Gene Expression Analysis Services.
PRODUCT SUPPORT
Technical Support
Presentations
Purchase Support
|